76 SKIN MICROBIOME
proliferation, hyperkeratinisation and inflammation, and systemic antibiotics are currently the first-line treatments for mild- to-moderate acne. Although highly effective, topical treatments affect skin barrier integrity and are often associated with side effects such as dryness, irritation, itching and redness.8
In this context, novel
therapies are in high demand and an ethnopharmacological approach to discover new plant sources of anti-acne therapeutics could contribute to filling this void in effective therapies. Exploitation of natural resources, especially medicinal plants and their derived products are considered as promising alternative agents for the treatment of diseases. Among them, Rhodomyrtus tomentosa
(RT) is a flowering plant belonging to the family Myrtaceae, native to southern and southeastern Asia. All parts of this plant (leaves, roots, buds, and fruits) have been used in traditional Vietnamese, Chinese and Malaysian medicine for a long time. In traditional medicine, RT fruits have been used to treat diarrhea and dysentery, and to boost the immune system.9
It contains
various phytochemical compounds in many parts of the plant: ellagitannins, stilbenes, anthocyanins, flavonols and phenolic acids being the phenolic compounds identified in the fruit. Recently, the acylphloroglucinol rhodomyrtone from RT fruit was evidenced as a potential inhibitor of inflammation. Moreover, rhodomyrtone showed strong antibacterial activity against a wide range of gram-positive pathogenic bacteria, as well as anti-biofilm property against Staphylococci causing severe infections. More specifically, rhodomyrtone inhibits C. acnes proliferation.10
After having characterised the
microbiota profile of skin areas with acne lesions, we investigated whether 28 days’ application of fruit Rhodomyrtus tomentosa extract (RT) modify this microbiota, with a focus on C. acnes phylotypes.
Methodology Participants
Seventeen volunteers were included by a dermatologist. Written informed consent and photography were obtained from each subject before enrolment. They were aged 17.3 ± 1.0 years with mild to moderate acne (Global Acne Severity Scale (GEA) II to III), presenting at least five papules and pustules on the face (not located on the nasal pyramid),26
and at
least six closed and open comedones on the face, including at least three on the forehead. Exclusion criteria were presence of any cutaneous lesion affecting the face apart from ongoing acne (i.e. vitiligo, psoriasis and seborrhoeic dermatitis), or any chronic or acute progressive disease, which may interfere with the study. Patients who
PERSONAL CARE EUROPE 2
1.8 1.6 1.4 1.2 1
0.8 0.6 0.4 0.2 0
0.0468 0.3943 0.9547 Wilcoxon p-value Figure 2: Shannon diversity index at the genus level using Wilcoxon test.
applied facial topical treatments during the preceding month including anti-acneic agents (retinoids, zinc, benzoyle peroxide), antimicrobial agents (antibiotics, antiseptic), corticosteroids or nonsteroid anti- inflammatory drugs (NSAID) or patients who took systemic anti-acneic treatment during the preceding month with antibiotics (tetracycline, macrolides, macrolide derivatives) or zinc, or patients treated with NSAID, corticosteroid, or antibiotics other than anti-acneic taken during the preceding month were not included. We also excluded patients treated with oral retinoids treatment or any hormonal treatment for contraceptive or anti-acneic purpose initiated or modified during the 12 preceding weeks. During treatment, none of the aforementioned treatments was allowed. Two visits were performed for subjects: at inclusion (D0), and at the end of the study (D28). At baseline, microbiological sampling were performed on 17 acne patients for microbiota studies. Besides, the dermatologist performed a clinical examination of the face at D0 and D28. Concomitant treatments, adverse events and treatment compliance were recorded.
Study product The study products were a gel containing Rhodomyrtus tomentosa fruit extract and a placebo based on the same gelling agent acrylates/C10-30 alkyl acrylate crosspolymer and where the dry mater active was replace by demineralized water. Each formulation provided the same penetration capacity thanks to the presence of the surfactant PEG-8 Caprylic/Capric Glycerides (1%). They were applied twice daily, on each half-face. Subjects were instructed not to change their hygiene habits or to apply other skin care products or topical drugs during the study on their face.
Microbiota sampling
On the first day of study (Day 0), skin samplings (swabs) were performed for each volunteer. Samples were collected by the same investigator on the cheeks, forehead, temple or chin of each patient’s face (depending on the location of acne lesions). Then, volunteers were asked to apply active formula on one face side, and placebo formula on the other side, twice a day for 4 weeks. New samples were performed at the end of treatment on day 28 (Day 28) for each volunteer and face side.
Swab treatment, DNA extraction and purification and 16S rDNA amplification/sequencing After sampling, swabs were immediately placed in PowerBead tubes containing cell lysing solution and beads, and were stored at -80°C until DNA extraction was performed. DNA extraction and purification were performed using Qiagen DNeasy PowerSoil Kit (Cat # 12888).
16S metagenomics 16SrDNA variables
regions V1 to V3 were amplified using primers pair 27F (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG). 16s DNA sequencing was performed on Illumina Miseq using paired-end technology. All sequences processing was performed using QIIME2 suite (
https://qiime2.org/) using default settings. After quality filtering, reads pairs were merged by overlapping and clustered and chimeric sequences were removed. OTU (operational taxonomic units) were assigned to sequences against Silva 132 rDNA database. To evaluate whether the active
ingredient affects populations of five bacterial species (Staphylococcus epidermidis, Staphylococcus aureus, Staphylococcus hominis, Cutibacterium acnes, and Cutibacterium granulosum, and
April 2020 0.5321
n D28 RT extract n D0 RT extract n D28 Placebo n D0 Placebo
Page 1 |
Page 2 |
Page 3 |
Page 4 |
Page 5 |
Page 6 |
Page 7 |
Page 8 |
Page 9 |
Page 10 |
Page 11 |
Page 12 |
Page 13 |
Page 14 |
Page 15 |
Page 16 |
Page 17 |
Page 18 |
Page 19 |
Page 20 |
Page 21 |
Page 22 |
Page 23 |
Page 24 |
Page 25 |
Page 26 |
Page 27 |
Page 28 |
Page 29 |
Page 30 |
Page 31 |
Page 32 |
Page 33 |
Page 34 |
Page 35 |
Page 36 |
Page 37 |
Page 38 |
Page 39 |
Page 40 |
Page 41 |
Page 42 |
Page 43 |
Page 44 |
Page 45 |
Page 46 |
Page 47 |
Page 48 |
Page 49 |
Page 50 |
Page 51 |
Page 52 |
Page 53 |
Page 54 |
Page 55 |
Page 56 |
Page 57 |
Page 58 |
Page 59 |
Page 60 |
Page 61 |
Page 62 |
Page 63 |
Page 64 |
Page 65 |
Page 66 |
Page 67 |
Page 68 |
Page 69 |
Page 70 |
Page 71 |
Page 72 |
Page 73 |
Page 74 |
Page 75 |
Page 76 |
Page 77 |
Page 78 |
Page 79 |
Page 80 |
Page 81 |
Page 82 |
Page 83 |
Page 84 |
Page 85 |
Page 86 |
Page 87 |
Page 88 |
Page 89 |
Page 90 |
Page 91 |
Page 92 |
Page 93 |
Page 94 |
Page 95 |
Page 96 |
Page 97 |
Page 98 |
Page 99 |
Page 100 |
Page 101 |
Page 102 |
Page 103 |
Page 104 |
Page 105 |
Page 106 |
Page 107 |
Page 108 |
Page 109 |
Page 110 |
Page 111 |
Page 112 |
Page 113 |
Page 114 |
Page 115 |
Page 116 |
Page 117 |
Page 118 |
Page 119 |
Page 120 |
Page 121 |
Page 122 |
Page 123 |
Page 124 |
Page 125 |
Page 126 |
Page 127 |
Page 128 |
Page 129 |
Page 130 |
Page 131 |
Page 132 |
Page 133 |
Page 134 |
Page 135 |
Page 136 |
Page 137 |
Page 138 |
Page 139 |
Page 140 |
Page 141 |
Page 142 |
Page 143 |
Page 144 |
Page 145 |
Page 146 |
Page 147 |
Page 148 |
Page 149 |
Page 150 |
Page 151 |
Page 152 |
Page 153 |
Page 154 |
Page 155 |
Page 156 |
Page 157 |
Page 158 |
Page 159 |
Page 160 |
Page 161 |
Page 162 |
Page 163 |
Page 164 |
Page 165 |
Page 166 |
Page 167 |
Page 168 |
Page 169 |
Page 170 |
Page 171 |
Page 172 |
Page 173 |
Page 174 |
Page 175 |
Page 176 |
Page 177 |
Page 178 |
Page 179 |
Page 180 |
Page 181 |
Page 182 |
Page 183 |
Page 184 |
Page 185 |
Page 186 |
Page 187 |
Page 188 |
Page 189 |
Page 190 |
Page 191 |
Page 192 |
Page 193 |
Page 194 |
Page 195 |
Page 196
