infection control & hospital epidemiology july 2017, vol. 38, no. 7 concise communication
Susceptibility of Nosocomial Staphylococcus aureus to Chlorhexidine After Implementation of a Hospital-wide Antiseptic Bathing Regimen
Cole
T.Marolf, BS;1 RoxanneAlter, MS;2 Elizabeth Lyden,MS;3 Paul D. Fey, PhD;2 Mark E. Rupp, MD1
Hospital use of chlorhexidine (CHX) containing antiseptics to decrease nosocomial infections may promote CHX resistance among pathogenic organisms. Nosocomial bloodstream-infecting Staphylo- coccus aureus isolates from before and after adoption of hospital-wide CHX bathing were tested for CHX susceptibility, and no decreased susceptibility or resistance-promoting genes were discovered.
Infect Control Hosp Epidemiol 2017;38:873–875
when CHX bathing was not in use. The 4 time periods are labeled A–D in Table 1.
Staphylococcus aureus Isolates
Isolates were retrieved from a freezer bank containing initial S. aureus bloodstream isolates from hospitalized patients. Isolates responsible for hospital-associated bacteremia, defined as bacteremia occurring greater than 72 hours after admission, were characterized. Staphylococcus aureus isolates recovered from patients known to be previously colonized with MRSA were excluded as non-nosocomial.
Bacterial Isolation, MIC Testing, and Determination of qacA/B Gene Presence
Healthcare-associated infections (HAIs) affect 4% of patients admitted to hospitals, with an estimated added cost of $9.8 billion annually in the United States. In response, hospitals have implemented patient bathing with chlorhexidine (CHX), showing documented success in reducing a variety of HAIs.1 CHX has activity against a broad spectrum of microbes and acts by various mechanisms, including inhibition of mem- brane enzymes and permeability disruption. Although the risk of acquired resistance to CHX is regarded as small, there is concern that use ofCHX will promote the emergence of CHX- resistant staphylococci.2 We examined the CHX susceptibility of hospital-associated S. aureus as well as carriage of resistance genes qacA/B, before and after implementation of routine CHX patient bathing over a 7.5-year period.
methods Clinical Setting and Study Design
Prior to February 2009, CHX bathing was not used for hos- pitalized patients at the Nebraska Medical Center, a 689-bed academic medical center. From February 2009 to August 2010, regular CHX patient bathing was implemented via bed baths with 4% chlorhexidine gluconate (Hibiclens, Molnlycke Healthcare, Gothenburg, Sweden) as previously described.3 In the last 6 months of the project (February 2010 to August 2010), all inpatients were regularly bathed with CHX. Fol- lowing this experimental period, CHX was removed from September 2010 to September 2011 and then reintroduced in October 2011. Therefore, CHX was used for patient bathing during 2 periods, each of which was preceded by at least a year
Chlorhexidine minimum inhibitory concentration (MIC) test- ing was performed utilizing Clinical Laboratory Standards Institute (CLSI) methodologies. Plates were incubated at 35°C for 16 hours. qacA/B genes were detected by polymerase chain reaction (PCR) using a single primer pair designed by National Center for Biotechnology Information: reference sequences pSA1379 (qacA) and pTZ2162 (qacB): 5’CCCAACAGTTA TGGATAGTTG3’ and 5’CGTCTAACATTGGATCAGAAC3’. A strain of MRSA known to contain both qacA and qacB was utilized as a positive control (Courtesy: J. Edgeworth, Guy’sand St. Thomas’,London,UK).
Statistical Analysis
The Kruskal-Wallis test was used to compare the distribution of MICs between periods. The Mann-Whitney test (for pairwise comparisons) was used to compare time periods, along with the Bonferroni method for P value adjustment. P<.05 was considered statistically significant.
results
Of 122 S. aureus strains meeting the nosocomial criteria, 104 were available for testing. Results of MIC testing are listed in Table 1. The highest chlorhexidine MIC was 2 µg/mL, for 4 isolates in the non–CHX-use baseline period (period A) and 3 isolates in the CHX-use period (period B). MIC mean and standard deviation (µg/mL) were 0.97 (SD, 0.46; period A), 0.75 (SD, 0.57; period B), 0.72 (SD, 0.26; period C), and 0.69 (SD, 0.25; period D). A statistically significant difference was observed in the distribution of MIC across the 4 periods (P=.008). Specifically, the mean MIC for period A was greater than for period B and was also greater than for period D (P=.048 and P=.024, respectively). None of the isolates tested contained qacA or qacB as assessed by PCR.
Page 1 |
Page 2 |
Page 3 |
Page 4 |
Page 5 |
Page 6 |
Page 7 |
Page 8 |
Page 9 |
Page 10 |
Page 11 |
Page 12 |
Page 13 |
Page 14 |
Page 15 |
Page 16 |
Page 17 |
Page 18 |
Page 19 |
Page 20 |
Page 21 |
Page 22 |
Page 23 |
Page 24 |
Page 25 |
Page 26 |
Page 27 |
Page 28 |
Page 29 |
Page 30 |
Page 31 |
Page 32 |
Page 33 |
Page 34 |
Page 35 |
Page 36 |
Page 37 |
Page 38 |
Page 39 |
Page 40 |
Page 41 |
Page 42 |
Page 43 |
Page 44 |
Page 45 |
Page 46 |
Page 47 |
Page 48 |
Page 49 |
Page 50 |
Page 51 |
Page 52 |
Page 53 |
Page 54 |
Page 55 |
Page 56 |
Page 57 |
Page 58 |
Page 59 |
Page 60 |
Page 61 |
Page 62 |
Page 63 |
Page 64 |
Page 65 |
Page 66 |
Page 67 |
Page 68 |
Page 69 |
Page 70 |
Page 71 |
Page 72 |
Page 73 |
Page 74 |
Page 75 |
Page 76 |
Page 77 |
Page 78 |
Page 79 |
Page 80 |
Page 81 |
Page 82 |
Page 83 |
Page 84 |
Page 85 |
Page 86 |
Page 87 |
Page 88 |
Page 89 |
Page 90 |
Page 91 |
Page 92 |
Page 93 |
Page 94 |
Page 95 |
Page 96 |
Page 97 |
Page 98 |
Page 99 |
Page 100 |
Page 101 |
Page 102 |
Page 103 |
Page 104 |
Page 105 |
Page 106 |
Page 107 |
Page 108 |
Page 109 |
Page 110 |
Page 111 |
Page 112 |
Page 113 |
Page 114 |
Page 115 |
Page 116 |
Page 117 |
Page 118 |
Page 119 |
Page 120 |
Page 121 |
Page 122 |
Page 123 |
Page 124 |
Page 125 |
Page 126 |
Page 127 |
Page 128 |
Page 129 |
Page 130 |
Page 131 |
Page 132 |
Page 133 |
Page 134 |
Page 135 |
Page 136
