search.noResults

search.searching

dataCollection.invalidEmail
note.createNoteMessage

search.noResults

search.searching

orderForm.title

orderForm.productCode
orderForm.description
orderForm.quantity
orderForm.itemPrice
orderForm.price
orderForm.totalPrice
orderForm.deliveryDetails.billingAddress
orderForm.deliveryDetails.deliveryAddress
orderForm.noItems
SKIN MICROBIOME 45


proliferation, hyperkeratinization and inflammation, and systemic antibiotics are currently the first-line treatments for mild- to-moderate acne. Although highly effective, topical treatments affect skin barrier integrity and are often associated with side effects such as dryness, irritation, itching and redness.8


In this context, novel


therapies are in high demand and an ethnopharmacological approach to discover new plant sources of anti-acne therapeutics could contribute to filling this void in effective therapies. Exploitation of natural resources, especially medicinal plants and their derived products are considered as promising alternative agents for the treatment of diseases. Among them, Rhodomyrtus tomentosa


(RT) is a flowering plant belonging to the family Myrtaceae, native to southern and southeastern Asia. All parts of this plant (leaves, roots, buds, and fruits) have been used in traditional Vietnamese, Chinese and Malaysian medicine for a long time. In traditional medicine, RT fruits have been used to treat diarrhea and dysentery, and to boost the immune system.9


It contains


various phytochemical compounds in many parts of the plant: ellagitannins, stilbenes, anthocyanins, flavonols and phenolic acids being the phenolic compounds identified in the fruit. Recently, the acylphloroglucinol rhodomyrtone from RT fruit was evidenced as a potential inhibitor of inflammation. Moreover, rhodomyrtone showed strong antibacterial activity against a wide range of gram-positive pathogenic bacteria, as well as anti-biofilm property against Staphylococci causing severe infections. More specifically, rhodomyrtone inhibits C. acnes proliferation.10


After having characterized the


microbiota profile of skin areas with acne lesions, we investigated whether 28 days’ application of fruit Rhodomyrtus tomentosa extract (RT) modify this microbiota, with a focus on C. acnes phylotypes.


Methodology Participants


Seventeen volunteers were included by a dermatologist. Written informed consent and photography were obtained from each subject before enrolment. They were aged 17.3 ± 1.0 years with mild to moderate acne (Global Acne Severity Scale (GEA) II to III), presenting at least five papules and pustules on the face (not located on the nasal pyramid),26


and at


least six closed and open comedones on the face, including at least three on the forehead. Exclusion criteria were presence of any cutaneous lesion affecting the face apart from ongoing acne (i.e. vitiligo, psoriasis and seborrhoeic dermatitis), or any chronic or acute progressive disease, which may interfere with the study. Patients who


March 2020 2


1.8 1.6 1.4 1.2 1


0.8 0.6 0.4 0.2 0


0.0468 0.3943 0.9547 Wilcoxon p-value Figure 2: Shannon diversity index at the genus level using Wilcoxon test.


applied facial topical treatments during the preceding month including anti-acneic agents (retinoids, zinc, benzoyle peroxide), antimicrobial agents (antibiotics, antiseptic), corticosteroids or nonsteroid anti- inflammatory drugs (NSAID) or patients who took systemic anti-acneic treatment during the preceding month with antibiotics (tetracycline, macrolides, macrolide derivatives) or zinc, or patients treated with NSAID, corticosteroid, or antibiotics other than anti-acneic taken during the preceding month were not included. We also excluded patients treated with oral retinoids treatment or any hormonal treatment for contraceptive or anti-acneic purpose initiated or modified during the 12 preceding weeks. During treatment, none of the aforementioned treatments was allowed. Two visits were performed for subjects: at inclusion (D0), and at the end of the study (D28). At baseline, microbiological sampling were performed on 17 acne patients for microbiota studies. Besides, the dermatologist performed a clinical examination of the face at D0 and D28. Concomitant treatments, adverse events and treatment compliance were recorded.


Study product The study products were a gel containing Rhodomyrtus tomentosa fruit extract and a placebo based on the same gelling agent acrylates/C10-30 alkyl acrylate crosspolymer and where the dry mater active was replace by demineralized water. Each formulation provided the same penetration capacity thanks to the presence of the surfactant PEG-8 Caprylic/Capric Glycerides (1%). They were applied twice daily, on each half-face. Subjects were instructed not to change their hygiene habits or to apply other skin care products or topical drugs during the study on their face.


Microbiota sampling


On the first day of study (Day 0), skin samplings (swabs) were performed for each volunteer. Samples were collected by the same investigator on the cheeks, forehead, temple or chin of each patient’s face (depending on the location of acne lesions). Then, volunteers were asked to apply active formula on one face side, and placebo formula on the other side, twice a day for 4 weeks. New samples were performed at the end of treatment on day 28 (Day 28) for each volunteer and face side.


Swab treatment, DNA extraction and purification and 16S rDNA amplification/sequencing After sampling, swabs were immediately placed in PowerBead tubes containing cell lysing solution and beads, and were stored at -80°C until DNA extraction was performed. DNA extraction and purification were performed using Qiagen DNeasy PowerSoil Kit (Cat # 12888).


16S metagenomics 16SrDNA variables


regions V1 to V3 were amplified using primers pair 27F (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG). 16s DNA sequencing was performed on Illumina Miseq using paired-end technology. All sequences processing was performed using QIIME2 suite (https://qiime2.org/) using default settings. After quality filtering, reads pairs were merged by overlapping and clustered and chimeric sequences were removed. OTU (operational taxonomic units) were assigned to sequences against Silva 132 rDNA database. To evaluate whether the active


ingredient affects populations of five bacterial species (Staphylococcus epidermidis, Staphylococcus aureus, Staphylococcus hominis, Cutibacterium acnes, and Cutibacterium granulosum, and


PERSONAL CARE NORTH AMERICA 0.5321


n D28 RT extract n D0 RT extract n D28 Placebo n D0 Placebo


Page 1  |  Page 2  |  Page 3  |  Page 4  |  Page 5  |  Page 6  |  Page 7  |  Page 8  |  Page 9  |  Page 10  |  Page 11  |  Page 12  |  Page 13  |  Page 14  |  Page 15  |  Page 16  |  Page 17  |  Page 18  |  Page 19  |  Page 20  |  Page 21  |  Page 22  |  Page 23  |  Page 24  |  Page 25  |  Page 26  |  Page 27  |  Page 28  |  Page 29  |  Page 30  |  Page 31  |  Page 32  |  Page 33  |  Page 34  |  Page 35  |  Page 36  |  Page 37  |  Page 38  |  Page 39  |  Page 40  |  Page 41  |  Page 42  |  Page 43  |  Page 44  |  Page 45  |  Page 46  |  Page 47  |  Page 48  |  Page 49  |  Page 50  |  Page 51  |  Page 52  |  Page 53  |  Page 54  |  Page 55  |  Page 56  |  Page 57  |  Page 58  |  Page 59  |  Page 60  |  Page 61  |  Page 62  |  Page 63  |  Page 64  |  Page 65  |  Page 66  |  Page 67  |  Page 68  |  Page 69  |  Page 70  |  Page 71  |  Page 72