This page contains a Flash digital edition of a book.
TCGTTTTGGTAGCTCTAGGTGTGCATGCATGAACACACTAGGATCGATCAGCACTCGACGTCGATCGAACTGGCATGTA GTGATGCTGATCGTAGCTGATGCGCGATGATAGTCGTACGTACGGCTAGCGCCGGCGCTAGTACTAGTACGTGACTAGT


BACK TO CONTENTS Genomics in practice


100,000 whole genomes sequenced by


However, one common and growing use of genomics is in the fi eld of pharmacogenomics– the technology that assesses the impact of genetic make-up on an individual’s response to drugs, which helps to increase effi cacy while minimising side effects.


Genomics England – a company owned by the Department of Health – plans to sequence 100,000 whole genomes by 2017, while a host of similar initiatives are taking place around the world, creating an ever-expanding library of genetic information. But despite signifi cant investment from governments, academic institutions and pharma companies, there have been few breakthroughs in genome-based therapeutic intervention.


This is considered to be the holy grail of genomics – a select group of treatments that actually modify the expression of genes to reduce the impact of disease – but what does exist is mainly restricted to certain forms of cancer. For example, trastuzumab is a monoclonal antibody that targets the HER2 gene in certain breast cancers, while another monoclonal antibody, cetuximab, is used to treat non-small cell lung cancer and metastatic colon cancer.


So although the number of genes proven to cause diseases rose from 53 in 1990 to 2,900 in 20132


– enabling scientists to screen patients and allow for


early diagnosis and treatment – only nine out of 61 recent genomics articles from leading journals relate to trials that show effective treatment, with the majority focusing on pathogenesis and underlying genetic causes of disease3


It seems that many scientists are struggling to overcome the complexity and excessive variables involved in linking genes to chronic disease, with only the largest organisations able to fund such high-risk research.


2 3


genome.gov/27553526 KPMG internal research


© 2014 KPMG LLP, a UK limited liability partnership, and a member fi rm of the KPMG network of independent member fi rms affi liated with KPMG International Cooperative, a Swiss entity. All rights reserved. .


An increasing number of drugs now carry pharmacogenomic medical information on their labels, providing a vital aid to doctors’ therapeutic choices. For example, an established association between certain genes and side effects means patients are routinely genotyped before being prescribed the antiretroviral therapy abacavir, to avoid an unwanted response. And it’s a similar story with the immunosuppressant azathioprine, with patients genotyped for the enzyme TMPT, which predicts their ability to deal with the drug’s toxicity.


Its effectiveness is also being seen in clinical trials. For example, the effi cacy of AstraZeneca’s anti-lung cancer drug IRESSA was questioned after its early use showed a high failure rate. However, after the introduction of genetic testing the success rate increased signifi cantly when the product was used only for patients with a specifi c EGFR mutation, leading to greater use by health providers and higher sales. Indeed, other under-performing blockbusters have been similarly revitalised thanks to sequencing of the target audience.


Yet genomic treatments are unlikely to achieve wider adoption without the clinical reassurance of improved patient outcomes, which is currently limited. Although there are some examples of


FOCUS 23


GENOMICS


Page 1  |  Page 2  |  Page 3  |  Page 4  |  Page 5  |  Page 6  |  Page 7  |  Page 8  |  Page 9  |  Page 10  |  Page 11  |  Page 12  |  Page 13  |  Page 14  |  Page 15  |  Page 16  |  Page 17  |  Page 18  |  Page 19  |  Page 20  |  Page 21  |  Page 22  |  Page 23  |  Page 24  |  Page 25  |  Page 26  |  Page 27  |  Page 28  |  Page 29  |  Page 30  |  Page 31  |  Page 32  |  Page 33  |  Page 34  |  Page 35  |  Page 36  |  Page 37  |  Page 38  |  Page 39  |  Page 40  |  Page 41